|
miRBase |
|
Stem-loop sequence mml-mir-642 |
|||||
| Accession | MI0007885 | ||||
| Description | Macaca mulatta miR-642 stem-loop | ||||
| Gene family | MIPF0000468; mir-642 | ||||
| Stem-loop |
--au c g ggu cugag ugggagg ucccucuccaaaugugucuugg g ||||| ||||||| |||||||||||||||||||||| g ggcuc acccucc agggagagguuuacacagaacu g cucc a a agg |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-642 |
|
| Accession | MIMAT0006483 |
| Sequence |
16 - gucccucuccaaaugugucuug - 37 |
| Evidence | by similarity; MI0003657 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|