![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-642 |
|||||
Accession | MI0007885 (change log) | ||||
Description | Macaca mulatta miR-642 stem-loop | ||||
Gene family | MIPF0000468; mir-642 | ||||
Stem-loop |
--au c g ggu 5' cugag ugggagg ucccucuccaaaugugucuugg g ||||| ||||||| |||||||||||||||||||||| g 3' ggcuc acccucc agggagagguuuacacagaacu g cucc a a agg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence mml-miR-642 |
|
Accession | MIMAT0006483 |
Sequence |
16 - gucccucuccaaaugugucuug - 37 |
Deep sequencing | 1 reads, 1 experiments |
Evidence | by similarity; MI0003657 |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|