Stem-loop sequence mml-mir-642

AccessionMI0007885 (change log)
DescriptionMacaca mulatta miR-642 stem-loop
Gene family MIPF0000468; mir-642
Stem-loop
   --au     c       g                      ggu 
5'     cugag ugggagg ucccucuccaaaugugucuugg   g
       ||||| ||||||| ||||||||||||||||||||||   g
3'     ggcuc acccucc agggagagguuuacacagaacu   g
   cucc     a       a                      agg 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 41017617-41017703 [+]
intergenic
Database links

Mature sequence mml-miR-642

Accession MIMAT0006483
Sequence

16 - 

gucccucuccaaaugugucuug

 - 37

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003657
Predicted targets

References

1