Stem-loop sequence mml-mir-642

Accession MI0007885
Description Macaca mulatta miR-642 stem-loop
Gene family MIPF0000468; mir-642
Stem-loop
--au     c       g                      ggu 
    cugag ugggagg ucccucuccaaaugugucuugg   g
    ||||| ||||||| ||||||||||||||||||||||   g
    ggcuc acccucc agggagagguuuacacagaacu   g
cucc     a       a                      agg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 52122176-52122262 [+]
sense
ENSMMUT00000009694 ; GIPR-201; intron 5
Database links

Mature sequence mml-miR-642

Accession MIMAT0006483
Sequence

16 - 

gucccucuccaaaugugucuug

 - 37

Get sequence
Evidence by similarity; MI0003657
Predicted targets

References

1