Stem-loop sequence mml-mir-642

AccessionMI0007885
DescriptionMacaca mulatta miR-642 stem-loop
Gene family MIPF0000468; mir-642
Stem-loop
--au     c       g                      ggu 
    cugag ugggagg ucccucuccaaaugugucuugg   g
    ||||| ||||||| ||||||||||||||||||||||   g
    ggcuc acccucc agggagagguuuacacagaacu   g
cucc     a       a                      agg 
Get sequence
Deep sequencing
31 reads, 1.55 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 51738740-51738826 [+]
intergenic
Database links

Mature sequence mml-miR-642

Accession MIMAT0006483
Sequence

16 - 

gucccucuccaaaugugucuug

 - 37

Get sequence
Evidence by similarity; MI0003657
Predicted targets

References

1