Stem-loop sequence mml-mir-640

AccessionMI0007884
DescriptionMacaca mulatta miR-640 stem-loop
Gene family MIPF0000494; mir-640
Stem-loop
------- ug   --cu     a       aa     aaca   ----     c 
       g  acc    gggca guuccug  gauca    cau    cagau c
       |  |||    ||||| |||||||  |||||    |||    ||||| c
       c  ugg    uccgu caaggac  cuagu    gua    gucua u
gagguuc gu   uauc     c       --     acgg   aaau     u 
Get sequence
Deep sequencing
18 reads, 1.02 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 19540725-19540820 [+]
intergenic
Database links

Mature sequence mml-miR-640

Accession MIMAT0006482
Sequence

61 - 

augauccaggaaccugccucu

 - 81

Get sequence
Evidence by similarity; MI0003655
Predicted targets

References

1