Stem-loop sequence mml-mir-640

Accession MI0007884
Description Macaca mulatta miR-640 stem-loop
Gene family MIPF0000494; mir-640
Stem-loop
------- ug   --cu     a       aa     aaca   ----     c 
       g  acc    gggca guuccug  gauca    cau    cagau c
       |  |||    ||||| |||||||  |||||    |||    ||||| c
       c  ugg    uccgu caaggac  cuagu    gua    gucua u
gagguuc gu   uauc     c       --     acgg   aaau     u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 19098527-19098622 [+]
intergenic
Database links

Mature sequence mml-miR-640

Accession MIMAT0006482
Sequence

61 - 

augauccaggaaccugccucu

 - 81

Get sequence
Evidence by similarity; MI0003655
Predicted targets

References

1