Stem-loop sequence mml-mir-638

Accession MI0007882
Description Macaca mulatta miR-638 stem-loop
Gene family MIPF0000486; mir-638
Stem-loop
guaagcg     g    gg u   g     -  ggcggccuagggugcggagg 
       ggcgc gcag  a cgc ggcgg gc                    g
       ||||| ||||  | ||| ||||| ||                    c
       ucgcg cguc  u gcg ccgcc cg                    g
-------     g    aa -   g     g  ucccucgcgguaagggccag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 10530545-10530644 [+]
sense
ENSMMUT00000038756 ; DNM2-201; intron 1
ENSMMUT00000020580 ; DNM2-202; intron 1
ENSMMUT00000038755 ; DNM2-203; intron 1
antisense
Database links

Mature sequence mml-miR-638

Accession MIMAT0006480
Sequence

16 - 

agggaucgcgggcgggcggcggccu

 - 40

Get sequence
Evidence by similarity; MI0003653
Predicted targets

References

1