Stem-loop sequence mml-mir-638

AccessionMI0007882
DescriptionMacaca mulatta miR-638 stem-loop
Gene family MIPF0000486; mir-638
Stem-loop
guaagcg     g    gg u   g     -  ggcggccuagggugcggagg 
       ggcgc gcag  a cgc ggcgg gc                    g
       ||||| ||||  | ||| ||||| ||                    c
       ucgcg cguc  u gcg ccgcc cg                    g
-------     g    aa -   g     g  ucccucgcgguaagggccag 
Get sequence
Deep sequencing
2 reads, 0.245 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-638

Accession MIMAT0006480
Sequence

16 - 

agggaucgcgggcgggcggcggccu

 - 40

Get sequence
Evidence by similarity; MI0003653
Predicted targets

References

1