Stem-loop sequence mml-mir-636

Accession MI0007881
Description Macaca mulatta miR-636 stem-loop
Gene family MIPF0000524; mir-636
Stem-loop
--ug  g       cggga  gc           c   -cc   u  cu  aa 
    gc gccuggg     gc  gcgggcggggc ggc   cgc gc  gg  u
    || |||||||     ||  ||||||||||| |||   ||| ||  ||   
    cg cggaucc     cg  cguccgcccug ucg   gug cg  cc  u
gcug  g       -----  -a           c   uuc   u  cc  aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
16: 72096874-72096972 [-]
sense
ENSMMUT00000031528 ; MMU.18054-201; exon 2
ENSMMUT00000040984 ; MMU.18054-202; exon 2
ENSMMUT00000031529 ; MMU.18054-203; exon 2
ENSMMUT00000040983 ; MMU.18054-204; intron 2
Database links

Mature sequence mml-miR-636

Accession MIMAT0006479
Sequence

61 - 

ugugcuugcucgucccgccugca

 - 83

Get sequence
Evidence by similarity; MI0003651
Predicted targets

References

1