Stem-loop sequence mml-mir-636

Accession MI0007881
Description Macaca mulatta miR-636 stem-loop
Gene family MIPF0000524; mir-636
Stem-loop
   --ug  g       cggga  gc           c   -cc   u  cu  aa 
5'     gc gccuggg     gc  gcgggcggggc ggc   cgc gc  gg  u
       || |||||||     ||  ||||||||||| |||   ||| ||  ||   
3'     cg cggaucc     cg  cguccgcccug ucg   gug cg  cc  u
   gcug  g       -----  -a           c   uuc   u  cc  aa 
Get sequence
Deep sequencing
4 reads, 0.149 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-636

Accession MIMAT0006479
Sequence

61 - 

ugugcuugcucgucccgccugca

 - 83

Get sequence
Evidence by similarity; MI0003651
Predicted targets

References

1