|
miRBase |
|
Stem-loop sequence mml-mir-633 |
|||||
| Accession | MI0007880 | ||||
| Description | Macaca mulatta miR-633 stem-loop | ||||
| Gene family | MIPF0000546; mir-633 | ||||
| Stem-loop |
aaccucucuuagccucuguuuc c aaa
uuua ugugguagauacuauuagccu a
|||| ||||||||||||||||||||| u
aaau acaccaucuaugauaaucgga a
-------auaguaguguuguua a aga
|
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-633 |
|
| Accession | MIMAT0006478 |
| Sequence |
61 - cuaauaguaucuaccacaauaaa - 83 |
| Evidence | by similarity; MI0003648 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|