Stem-loop sequence mml-mir-633

AccessionMI0007880
DescriptionMacaca mulatta miR-633 stem-loop
Gene family MIPF0000546; mir-633
Stem-loop
aaccucucuuagccucuguuuc    c                     aaa 
                      uuua ugugguagauacuauuagccu   a
                      |||| |||||||||||||||||||||   u
                      aaau acaccaucuaugauaaucgga   a
-------auaguaguguuguua    a                     aga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr16: 60463996-60464093 [+]
intergenic
Database links

Mature sequence mml-miR-633

Accession MIMAT0006478
Sequence

61 - 

cuaauaguaucuaccacaauaaa

 - 83

Get sequence
Evidence by similarity; MI0003648
Predicted targets

References

1