Stem-loop sequence mml-mir-632

AccessionMI0007879 (change log)
DescriptionMacaca mulatta miR-632 stem-loop
Gene family MIPF0000527; mir-632
Stem-loop
   ---------------------------------------------------------------         ccg     
5'                                                                cgccuccug   cagu 
                                                                  |||||||||   ||| g
3'                                                                gcggagggc   gucc 
   ugccgaugcuggcgcaggguguccuucgucuguguuuuaccggcugccggagcaagcggcgag         --a     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 26364686-26364779 [+]
antisense
ENSMMUT00000015980 ; ACCN1-201; intron 4
Database links

Mature sequence mml-miR-632

Accession MIMAT0006477
Sequence

61 - 

gugucugcuuccuguggga

 - 79

Get sequence
Evidence by similarity; MI0003647
Predicted targets

References

1