Stem-loop sequence mml-mir-631

AccessionMI0007878
DescriptionMacaca mulatta miR-631 stem-loop
Gene family MIPF0000508; mir-631
Stem-loop
gu      cc    uaga      c   a  -      a 
  ggagag  uggu    ccuggc cag cc ucagcu c
  ||||||  ||||    |||||| ||| || |||||| a
  ccucuc  accg    ggacug guc gg agucga c
--      ac    ---g      a   a  u      a 
Get sequence
Deep sequencing
3 reads, 3.09 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-631

Accession MIMAT0006476
Sequence

16 - 

agaccuggcccagaccucagc

 - 36

Get sequence
Evidence by similarity; MI0003645
Predicted targets

References

1