Stem-loop sequence mml-mir-628

Accession MI0007877
Description Macaca mulatta miR-628 stem-loop
Gene family MIPF0000529; mir-628
Stem-loop
auagcugu  u   a      ca  -   a   a             aaaa 
        ug guc cuuccu  ug cug cau uuuacuagagggu    u
        || ||| ||||||  || ||| ||| |||||||||||||     
        ac cag gaaggg  gc gac gug gaaugaucuucca    u
-------u  u   -      aa  u   g   a             auaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 33721725-33721819 [-]
sense
ENSMMUT00000015098 ; MMU.17626-201; intron 2
ENSMMUT00000015095 ; MMU.17626-202; intron 2
ENSMMUT00000015096 ; MMU.17626-203; intron 2
ENSMMUT00000040541 ; MMU.17626-204; intron 2
Database links

Mature sequence mml-miR-628-5p

Accession MIMAT0006474
Sequence

23 - 

augcugacauauuuacuagagg

 - 44

Get sequence
Evidence by similarity; MI0003642
Predicted targets

Mature sequence mml-miR-628-3p

Accession MIMAT0006475
Sequence

61 - 

ucuaguaagaguggcagucga

 - 81

Get sequence
Evidence by similarity; MI0003642
Predicted targets

References

1