Stem-loop sequence mml-mir-628

AccessionMI0007877 (change log)
DescriptionMacaca mulatta miR-628 stem-loop
Gene family MIPF0000529; mir-628
Stem-loop
   auagcugu  u   a      ca  -   a   a             aaaa 
5'         ug guc cuuccu  ug cug cau uuuacuagagggu    u
           || ||| ||||||  || ||| ||| |||||||||||||     
3'         ac cag gaaggg  gc gac gug gaaugaucuucca    u
   -------u  u   -      aa  u   g   a             auaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 31855108-31855202 [-]
antisense
ENSMMUT00000021083 ; UNC13C-201; intron 4
Database links

Mature sequence mml-miR-628-5p

Accession MIMAT0006474
Sequence

23 - 

augcugacauauuuacuagagg

 - 44

Get sequence
Evidence by similarity; MI0003642
Database links
Predicted targets

Mature sequence mml-miR-628-3p

Accession MIMAT0006475
Sequence

61 - 

ucuaguaagaguggcagucga

 - 81

Get sequence
Evidence by similarity; MI0003642
Predicted targets

References

1