Stem-loop sequence mml-mir-627

Accession MI0007876
Description Macaca mulatta miR-627 stem-loop
Gene family MIPF0000550; mir-627
Stem-loop
---------ua        c            g               ug u 
           cuuauuac gguagugagucu uaagaaaagaggagg  g g
           |||||||| |||||||||||| |||||||||||||||  |  
           gaauaaug ccaucacucaga auucuuuucuccucc  u g
aucaucauaaa        a            g               uu u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-627-5p

Accession MIMAT0026904
Sequence

17 - 

ugagucuguaagaaaagaggag

 - 38

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-627-3p

Accession MIMAT0006473
Sequence

52 - 

uccucuuuucuuagagacucac

 - 73

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).