Stem-loop sequence mml-mir-627

AccessionMI0007876 (change log)
DescriptionMacaca mulatta miR-627 stem-loop
Gene family MIPF0000550; mir-627
Stem-loop
   ---------ua        c            g               ug u 
5'            cuuauuac gguagugagucu uaagaaaagaggagg  g g
              |||||||| |||||||||||| |||||||||||||||  |  
3'            gaauaaug ccaucacucaga auucuuuucuccucc  u g
   aucaucauaaa        a            g               uu u 
Get sequence
Deep sequencing
15777 reads, 44.4 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 18594909-18595005 [-]
intergenic
Database links

Mature sequence mml-miR-627-5p

Accession MIMAT0026904
Sequence

17 - 

ugagucuguaagaaaagaggag

 - 38

Get sequence
Deep sequencing15776 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-627-3p

Accession MIMAT0006473
Sequence

52 - 

uccucuuuucuuagagacucac

 - 73

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).