Stem-loop sequence mml-mir-625

AccessionMI0007874
DescriptionMacaca mulatta miR-625 stem-loop
Gene family MIPF0000534; mir-625
Stem-loop
           auaa                  g    uaau 
aggguagaggu    ggggggaaaguucugcag ccug    u
|||||||||||    |||||||||||||||||| ||||    a
ucccgucucca    ucccucuuucaagauguc ggac    g
           ---c                  a    ucua 
Get sequence
Deep sequencing
3 reads, 0.104 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-625

Accession MIMAT0006471
Sequence

52 - 

ggacuguagaacuuucucccu

 - 72

Get sequence
Evidence by similarity; MI0003639
Predicted targets

References

1