Stem-loop sequence mml-mir-625

Accession MI0007874
Description Macaca mulatta miR-625 stem-loop
Gene family MIPF0000534; mir-625
Stem-loop
              auaa                  g    uaau 
5' aggguagaggu    ggggggaaaguucugcag ccug    u
   |||||||||||    |||||||||||||||||| ||||    a
3' ucccgucucca    ucccucuuucaagauguc ggac    g
              ---c                  a    ucua 
Get sequence
Deep sequencing
3 reads, 0.104 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-625

Accession MIMAT0006471
Sequence

52 - 

ggacuguagaacuuucucccu

 - 72

Get sequence
Evidence by similarity; MI0003639
Predicted targets

References

1