Stem-loop sequence mml-mir-625

Accession MI0007874
Description Macaca mulatta miR-625 stem-loop
Gene family MIPF0000534; mir-625
Stem-loop
           auaa                  g    uaau 
aggguagaggu    ggggggaaaguucugcag ccug    u
|||||||||||    |||||||||||||||||| ||||    a
ucccgucucca    ucccucuuucaagauguc ggac    g
           ---c                  a    ucua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 128513127-128513210 [+]
sense
ENSMMUT00000039800 ; FUT8-201; intron 1
ENSMMUT00000019433 ; FUT8-202; intron 2
ENSMMUT00000019434 ; FUT8-203; intron 2
ENSMMUT00000019435 ; FUT8-204; intron 2
Database links

Mature sequence mml-miR-625

Accession MIMAT0006471
Sequence

52 - 

ggacuguagaacuuucucccu

 - 72

Get sequence
Evidence by similarity; MI0003639
Predicted targets

References

1