Stem-loop sequence mml-mir-625

AccessionMI0007874 (change log)
DescriptionMacaca mulatta miR-625 stem-loop
Gene family MIPF0000534; mir-625
Stem-loop
              aua                  g    uaau 
5' aggguagaggu   agggggaaaguucugcag ccug    u
   |||||||||||   |||||||||||||||||| ||||    a
3' ucccgucucca   ucccucuuucaagauguc ggac    g
              --c                  a    ucua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 127503454-127503536 [+]
intergenic
Database links

Mature sequence mml-miR-625

Accession MIMAT0006471
Sequence

51 - 

ggacuguagaacuuucucccu

 - 71

Get sequence
Evidence by similarity; MI0003639
Predicted targets

References

1