Stem-loop sequence mml-mir-624

DescriptionMacaca mulatta miR-624 stem-loop
Gene family MIPF0000523; mir-624
   ------------                                   -- ag  g 
5'             aaugcuguuucaagguaguaccaguaucuuguguu  c  ug a
               |||||||||||||||||||||||||||||||||||  |  ||  
3'             uuacgauagaguuccauuauggucauagaacacaa  g  ac a
   gugaauccacaa                                   au ga  c 
Get sequence
Deep sequencing
26 reads, 2.49 reads per million, 8 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 93718430-93718527 [-]
Database links

Mature sequence mml-miR-624

Accession MIMAT0006470

54 - 


 - 74

Get sequence
Evidence by similarity; MI0003638
Predicted targets
