Stem-loop sequence mml-mir-624

Accession MI0007873
Description Macaca mulatta miR-624 stem-loop
Gene family MIPF0000523; mir-624
Stem-loop
------------                                   -- ag  g 
            aaugcuguuucaagguaguaccaguaucuuguguu  c  ug a
            |||||||||||||||||||||||||||||||||||  |  ||  
            uuacgauagaguuccauuauggucauagaacacaa  g  ac a
gugaauccacaa                                   au ga  c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 93961142-93961239 [-]
sense
ENSMMUT00000016132 ; STRN3-202; intron 1
Database links

Mature sequence mml-miR-624

Accession MIMAT0006470
Sequence

54 - 

cacaagauacugguauuaccu

 - 74

Get sequence
Evidence by similarity; MI0003638
Predicted targets

References

1