Stem-loop sequence mml-mir-619

AccessionMI0007872
DescriptionMacaca mulatta miR-619 stem-loop
Gene family MIPF0000557; mir-619
Stem-loop
cgcccaccucagccucccaaaaugcugggauua      ug   caccg   -  ga 
                                 caggca  agc     cag uc  c
                                 ||||||  |||     ||| ||   
                                 guccgu  uug     guc ag  c
----------------gacguuugacuguuagg      gu   uacag   u  ua 
Get sequence
Deep sequencing
454 reads, 56.1 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-619

Accession MIMAT0006469
Sequence

61 - 

gaucuggacauguuugugcc

 - 80

Get sequence
Evidence by similarity; MI0003633
Predicted targets

References

1