Stem-loop sequence mml-mir-619

Accession MI0007872
Description Macaca mulatta miR-619 stem-loop
Gene family MIPF0000557; mir-619
Stem-loop
   cgcccaccucagccucccaaaaugcugggauua      ug   caccg   -  ga 
5'                                  caggca  agc     cag uc  c
                                    ||||||  |||     ||| ||   
3'                                  guccgu  uug     guc ag  c
   ----------------gacguuugacuguuagg      gu   uacag   u  ua 
Get sequence
Deep sequencing
454 reads, 56.1 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-619

Accession MIMAT0006469
Sequence

61 - 

gaucuggacauguuugugcc

 - 80

Get sequence
Evidence by similarity; MI0003633
Predicted targets

References

1