Stem-loop sequence mml-mir-619

Accession MI0007872
Description Macaca mulatta miR-619 stem-loop
Gene family MIPF0000557; mir-619
Stem-loop
cgcccaccucagccucccaaaaugcugggauua      ug   caccg   -  ga 
                                 caggca  agc     cag uc  c
                                 ||||||  |||     ||| ||   
                                 guccgu  uug     guc ag  c
----------------gacguuugacuguuagg      gu   uacag   u  ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
11: 109849497-109849595 [-]
intergenic
Database links

Mature sequence mml-miR-619

Accession MIMAT0006469
Sequence

61 - 

gaucuggacauguuugugcc

 - 80

Get sequence
Evidence by similarity; MI0003633
Predicted targets

References

1