Stem-loop sequence mml-mir-618

Accession MI0007871
Description Macaca mulatta miR-618 stem-loop
Gene family MIPF0000553; mir-618
Stem-loop
-------u          acca      ac   u          gugau   g    
        cuuguucaca    aacucu  uug ccuucugagu     uac ccc 
        ||||||||||    ||||||  ||| ||||||||||     ||| || a
        ggauaggugu    uuggga  aac ggaggacucg     aug ggu 
aaaagucu          ccca      ca   -          -----   a    
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
11: 77881199-77881298 [-]
sense
ENSMMUT00000016346 ; LIN7A-201; intron 1
Database links

Mature sequence mml-miR-618

Accession MIMAT0006468
Sequence

15 - 

aaacucuacuuguccuucugagu

 - 37

Get sequence
Evidence by similarity; MI0003632
Predicted targets

References

1