Stem-loop sequence mml-mir-618

AccessionMI0007871 (change log)
DescriptionMacaca mulatta miR-618 stem-loop
Gene family MIPF0000553; mir-618
Stem-loop
   -------u          acca      ac   u          gugau   g    
5'         cuuguucaca    aacucu  uug ccuucugagu     uac ccc 
           ||||||||||    ||||||  ||| ||||||||||     ||| || a
3'         ggauaggugu    uuggga  aac ggaggacucg     aug ggu 
   aaaagucu          ccca      ca   -          -----   a    
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 79828537-79828636 [-]
sense
ENSMMUT00000019384 ; PPFIA2-202; intron 6
Database links

Mature sequence mml-miR-618

Accession MIMAT0006468
Sequence

15 - 

aaacucuacuuguccuucugagu

 - 37

Get sequence
Evidence by similarity; MI0003632
Predicted targets

References

1