Stem-loop sequence mml-mir-615

AccessionMI0007869 (change log)
DescriptionMacaca mulatta miR-615 stem-loop
Gene family MIPF0000342; mir-615
Stem-loop
   cuc   -a    c          uc     u        cu    g ug 
5'    ggg  gggg ggaagggggg  cccgg gcucggau  cgag g  c
      |||  |||| ||||||||||  ||||| ||||||||  |||| |  u
3'    ccc  cccc ccuucucccu  ggguc cgagccug  gcuu u  u
   ccc   aa    -          cu     -        --    g ua 
Get sequence
Deep sequencing
524 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 52703043-52703138 [+]
intergenic
Database links

Mature sequence mml-miR-615-5p

Accession MIMAT0006465
Sequence

18 - 

ggggguccccggugcucggauc

 - 39

Get sequence
Deep sequencing118 reads, 3 experiments
Evidence by similarity; MI0003628
Predicted targets

Mature sequence mml-miR-615-3p

Accession MIMAT0006466
Sequence

61 - 

uccgagccugggucucccucuu

 - 82

Get sequence
Deep sequencing404 reads, 7 experiments
Evidence by similarity; MI0003628
Predicted targets

References

1