Stem-loop sequence mml-mir-611

Accession MI0007867
Description Macaca mulatta miR-611 stem-loop
Gene family MIPF0000539; mir-611
Stem-loop
   aaaau   g   ggg ua     agu   -  a  g 
5'      ggu aga   u  agggg   ucc cg cg a
        ||| |||   |  |||||   ||| || ||  
3'      cca ucu   g  ucccc   agg gc gu g
   -acac   g   -gg gc     ---   a  -  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-611

Accession MIMAT0006463
Sequence

40 - 

gcgaggaccccucggggucugac

 - 62

Get sequence
Evidence by similarity; MI0003624
Predicted targets

References

1