Stem-loop sequence mml-mir-611

AccessionMI0007867 (change log)
DescriptionMacaca mulatta miR-611 stem-loop
Gene family MIPF0000539; mir-611
Stem-loop
   aaaauggugagaggguuaaggggaguucccgacggagaugcga      c 
5'                                            ggaccc u
                                              ||||||  
3'                                            ucuggg c
   -----------------------------------acacccag      g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 12498027-12498093 [+]
intergenic
Database links

Mature sequence mml-miR-611

Accession MIMAT0006463
Sequence

40 - 

gcgaggaccccucggggucugac

 - 62

Get sequence
Evidence by similarity; MI0003624
Predicted targets

References

1