|
miRBase |
|
Stem-loop sequence mml-mir-611 |
|||||
| Accession | MI0007867 | ||||
| Description | Macaca mulatta miR-611 stem-loop | ||||
| Gene family | MIPF0000539; mir-611 | ||||
| Stem-loop |
aaaau g ggg ua agu - a g
ggu aga u agggg ucc cg cg a
||| ||| | ||||| ||| || ||
cca ucu g ucccc agg gc gu g
-acac g -gg gc --- a - a
|
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-611 |
|
| Accession | MIMAT0006463 |
| Sequence |
40 - gcgaggaccccucggggucugac - 62 |
| Evidence | by similarity; MI0003624 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|