Stem-loop sequence mml-mir-609

AccessionMI0007866 (change log)
DescriptionMacaca mulatta miR-609 stem-loop
Gene family MIPF0000516; mir-609
Stem-loop
   ---ug       u        g                 -  c   aa 
5'      cucugcu uuccuagg uguugcucucaucucug gu uau  u
        ||||||| |||||||| ||||||||||||||||| || |||   
3'      gagacga aaggaucc acaacgggaguagagau ua aug  g
   ccaag       c        g                 g  a   gg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 100043792-100043885 [-]
sense
ENSMMUT00000002175 ; C10orf76-201; intron 22
Database links

Mature sequence mml-miR-609

Accession MIMAT0006462
Sequence

16 - 

aggguguugcucucaucucu

 - 35

Get sequence
Evidence by similarity; MI0003622
Predicted targets

References

1