Stem-loop sequence mml-mir-607

DescriptionMacaca mulatta miR-607 stem-loop
Gene family MIPF0000480; mir-607
   ucgc                              g            c 
5'     ccaaagucacacagguuauagaucuggauu gaacccagguag c
       |||||||||||||||||||||||||||||| |||||||||||| a
3'     gguuucaguguguccaaugucuagaccuaa uuuggguccguc g
   ----                              g            a 
Get sequence
Deep sequencing
6 reads, 0.942 reads per million, 6 experiments
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-607

Accession MIMAT0006461

19 - 


 - 39

Get sequence
Evidence by similarity; MI0003620
Predicted targets
