Stem-loop sequence mml-mir-607

Accession MI0007865
Description Macaca mulatta miR-607 stem-loop
Gene family MIPF0000480; mir-607
Stem-loop
ucgc                              g            c 
    ccaaagucacacagguuauagaucuggauu gaacccagguag c
    |||||||||||||||||||||||||||||| |||||||||||| a
    gguuucaguguguccaaugucuagaccuaa uuuggguccguc g
----                              g            a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1099214736729: 30212-30306 [+]
intergenic
Database links

Mature sequence mml-miR-607

Accession MIMAT0006461
Sequence

19 - 

guuauagaucuggauuggaac

 - 39

Get sequence
Evidence by similarity; MI0003620
Predicted targets

References

1