Stem-loop sequence mml-mir-607

AccessionMI0007865 (change log)
DescriptionMacaca mulatta miR-607 stem-loop
Gene family MIPF0000480; mir-607
Stem-loop
   ucgc                              g            c 
5'     ccaaagucacacagguuauagaucuggauu gaacccagguag c
       |||||||||||||||||||||||||||||| |||||||||||| a
3'     gguuucaguguguccaaugucuagaccuaa uuuggguccguc g
   ----                              g            a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 92319446-92319540 [+]
intergenic
Database links

Mature sequence mml-miR-607

Accession MIMAT0006461
Sequence

19 - 

guuauagaucuggauuggaac

 - 39

Get sequence
Evidence by similarity; MI0003620
Predicted targets

References

1