Stem-loop sequence mml-mir-607

AccessionMI0007865
DescriptionMacaca mulatta miR-607 stem-loop
Gene family MIPF0000480; mir-607
Stem-loop
ucgc                              g            c 
    ccaaagucacacagguuauagaucuggauu gaacccagguag c
    |||||||||||||||||||||||||||||| |||||||||||| a
    gguuucaguguguccaaugucuagaccuaa uuuggguccguc g
----                              g            a 
Get sequence
Deep sequencing
6 reads, 0.942 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-607

Accession MIMAT0006461
Sequence

19 - 

guuauagaucuggauuggaac

 - 39

Get sequence
Evidence by similarity; MI0003620
Predicted targets

References

1