Stem-loop sequence mml-mir-605

AccessionMI0007864 (change log)
DescriptionMacaca mulatta miR-605 stem-loop
Gene family MIPF0000528; mir-605
Stem-loop
   c                                  cu  gg 
5'  ccuagcuugguucuaaaucccacggugccuucuc  ug  a
    ||||||||||||||||||||||||||||||||||  ||  a
3'  ggauugaaccaagauuuagggugucacggaagag  ac  a
   -                                  --  aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 81534757-81534838 [-]
antisense
ENSMMUT00000013680 ; PCDH15-201; intron 31
Database links

Mature sequence mml-miR-605

Accession MIMAT0006460
Sequence

15 - 

uaaaucccacggugccuucuccu

 - 37

Get sequence
Evidence by similarity; MI0003618
Predicted targets

References

1