Stem-loop sequence mml-mir-605

DescriptionMacaca mulatta miR-605 stem-loop
Gene family MIPF0000528; mir-605
   c                                  cu  gg 
5'  ccuagcuugguucuaaaucccacggugccuucuc  ug  a
    ||||||||||||||||||||||||||||||||||  ||  a
3'  ggauugaaccaagauuuagggugucacggaagag  ac  a
   -                                  --  aa 
Get sequence
Deep sequencing
4552 reads, 90 reads per million, 8 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr9: 83502119-83502200 [-]
ENSMMUT00000013680 ; PCDH15-201; intron 31
Database links

Mature sequence mml-miR-605

Accession MIMAT0006460

15 - 


 - 37

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003618
Predicted targets
