Stem-loop sequence mml-mir-605

AccessionMI0007864
DescriptionMacaca mulatta miR-605 stem-loop
Gene family MIPF0000528; mir-605
Stem-loop
c                                  cu  gg 
 ccuagcuugguucuaaaucccacggugccuucuc  ug  a
 ||||||||||||||||||||||||||||||||||  ||  a
 ggauugaaccaagauuuagggugucacggaagag  ac  a
-                                  --  aa 
Get sequence
Deep sequencing
4552 reads, 90 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr9: 83502119-83502200 [-]
antisense
ENSMMUT00000013680 ; PCDH15-201; intron 31
Database links

Mature sequence mml-miR-605

Accession MIMAT0006460
Sequence

15 - 

uaaaucccacggugccuucuccu

 - 37

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003618
Predicted targets

References

1