Stem-loop sequence mml-mir-605

Accession MI0007864
Description Macaca mulatta miR-605 stem-loop
Gene family MIPF0000528; mir-605
Stem-loop
c                                  cu  gg 
 ccuagcuugguucuaaaucccacggugccuucuc  ug  a
 ||||||||||||||||||||||||||||||||||  ||  a
 ggauugaaccaagauuuagggugucacggaagag  ac  a
-                                  --  aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1099214739355: 6911-6992 [+]
intergenic
Database links

Mature sequence mml-miR-605

Accession MIMAT0006460
Sequence

15 - 

uaaaucccacggugccuucuccu

 - 37

Get sequence
Evidence by similarity; MI0003618
Predicted targets

References

1