|
miRBase |
|
Stem-loop sequence mml-mir-601 |
|||||
| Accession | MI0007862 | ||||
| Description | Macaca mulatta miR-601 stem-loop | ||||
| Gene family | MIPF0000522; mir-601 | ||||
| Stem-loop |
ugcaugag ug ----c g a - ca uucaucu gu uaggauu uugg gg agu g ||||||| || ||||||| |||| || ||| a agguggg ua guccuag gacc cc uua a -------- gu cugaa g - a aa |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-601 |
|
| Accession | MIMAT0006458 |
| Sequence |
16 - uggucuaggauuguuggaggag - 37 |
| Evidence | by similarity; MI0003614 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|