Stem-loop sequence mml-mir-601

Accession MI0007862
Description Macaca mulatta miR-601 stem-loop
Gene family MIPF0000522; mir-601
Stem-loop
ugcaugag       ug  ----c       g    a  -   ca 
        uucaucu  gu     uaggauu uugg gg agu  g
        |||||||  ||     ||||||| |||| || |||  a
        agguggg  ua     guccuag gacc cc uua  a
--------       gu  cugaa       g    -  a   aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
15: 12332607-12332685 [+]
sense
ENSMMUT00000008907 ; DENND1A-202; intron 23
Database links

Mature sequence mml-miR-601

Accession MIMAT0006458
Sequence

16 - 

uggucuaggauuguuggaggag

 - 37

Get sequence
Evidence by similarity; MI0003614
Predicted targets

References

1