Stem-loop sequence mml-mir-600

Accession MI0007861
Description Macaca mulatta miR-600 stem-loop
Gene family MIPF0000484; mir-600
Stem-loop
aagucacuuacugugucucca    cac  g               ca   ag 
                     gcuu   ag aaggcucuugucugu  ggc  u
                     ||||   || |||||||||||||||  |||   
                     cgga   uc uuccgagaacagaca  uug  g
----------cccgucccgac    --c  g               --   ag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
15: 12615442-12615535 [+]
intergenic
Database links

Mature sequence mml-miR-600

Accession MIMAT0006457
Sequence

57 - 

aguuacagacaagagccuugcuc

 - 79

Get sequence
Evidence by similarity; MI0003613
Predicted targets

References

1