Stem-loop sequence mml-mir-600

Accession MI0007861
Description Macaca mulatta miR-600 stem-loop
Gene family MIPF0000484; mir-600
   aagucacuuacugugucucca    cac  g               ca   ag 
5'                      gcuu   ag aaggcucuugucugu  ggc  u
                        ||||   || |||||||||||||||  |||   
3'                      cgga   uc uuccgagaacagaca  uug  g
   ----------cccgucccgac    --c  g               --   ag 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr15: 12534519-12534612 [+]
Database links

Mature sequence mml-miR-600

Accession MIMAT0006457

57 - 


 - 79

Get sequence
Evidence by similarity; MI0003613
Predicted targets
