Stem-loop sequence mml-mir-599

Accession MI0007860
Description Macaca mulatta miR-599 stem-loop
Gene family MIPF0000502; mir-599
Stem-loop
   aaagacaugcu     c     --                 gg     -   u 
5'            gucca agugu  guuugauaagcugacau  gacag gga u
              ||||| |||||  |||||||||||||||||  ||||| ||| c
3'            uaggu ucaua  caaacuauuugacugug  uuguc cuu u
   --------cag     -     cc                 --     a   u 
Get sequence
Deep sequencing
565 reads, 23.4 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 104391537-104391631 [-]
sense
ENSMMUT00000029526 ; NCALD-201; intron 4
Clustered miRNAs
< 10kb from mml-mir-599
mml-mir-875 chr8: 104391687-104391762 [-]
mml-mir-599 chr8: 104391537-104391631 [-]
Database links

Mature sequence mml-miR-599-5p

Accession MIMAT0026903
Sequence

24 - 

uuugauaagcugacaugggaca

 - 45

Get sequence
Deep sequencing 6 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-599-3p

Accession MIMAT0006456
Sequence

61 - 

guugugucaguuuaucaaac

 - 80

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).