Stem-loop sequence mml-mir-599

Accession MI0007860
Description Macaca mulatta miR-599 stem-loop
Gene family MIPF0000502; mir-599
Stem-loop
aaagacaugcu     c     --                 gg     -   u 
           gucca agugu  guuugauaagcugacau  gacag gga u
           ||||| |||||  |||||||||||||||||  ||||| ||| c
           uaggu ucaua  caaacuauuugacugug  uuguc cuu u
--------cag     -     cc                 --     a   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
8: 102057827-102057921 [-]
sense
antisense
ENSMMUT00000031207 ; VPS13B-201; intron 30
ENSMMUT00000031206 ; VPS13B-204; intron 30
ENSMMUT00000031205 ; VPS13B-203; intron 31
Clustered miRNAs
< 10kb from mml-mir-599
mml-mir-875 8: 102057977-102058052 [-]
mml-mir-599 8: 102057827-102057921 [-]
Database links

Mature sequence mml-miR-599-5p

Accession MIMAT0026903
Sequence

24 - 

uuugauaagcugacaugggaca

 - 45

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-599-3p

Accession MIMAT0006456
Sequence

61 - 

guugugucaguuuaucaaac

 - 80

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).