Stem-loop sequence mml-mir-598

AccessionMI0007859 (change log)
DescriptionMacaca mulatta miR-598 stem-loop
Gene family MIPF0000393; mir-598
   gcuugaugaugcugcugaugcu         cc     gu  g   uggaa 
5'                       ggcggugau  cgaug  gu agc     a
                         |||||||||  |||||  || |||      
3'                       cugcuacug  gcuac  ca ucg     u
   ------gagccuacuacuacua         uu     ug  -   ugggg 
Get sequence
Deep sequencing
503788 reads, 2.64e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 8706042-8706138 [+]
ENSMMUT00000014215 ; XKR6-201; intron 1
Database links

Mature sequence mml-miR-598-5p

Accession MIMAT0026902

24 - 


 - 46

Get sequence
Deep sequencing157 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-598-3p

Accession MIMAT0006455

61 - 


 - 82

Get sequence
Deep sequencing503615 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets


PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).