Stem-loop sequence mml-mir-598

AccessionMI0007859
DescriptionMacaca mulatta miR-598 stem-loop
Gene family MIPF0000393; mir-598
Stem-loop
gcuugaugaugcugcugaugcu         cc     gu  g   uggaa 
                      ggcggugau  cgaug  gu agc     a
                      |||||||||  |||||  || |||      
                      cugcuacug  gcuac  ca ucg     u
------gagccuacuacuacua         uu     ug  -   ugggg 
Get sequence
Deep sequencing
30635 reads, 405 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 9676762-9676858 [+]
sense
ENSMMUT00000014215 ; XKR6-201; intron 1
Database links

Mature sequence mml-miR-598-5p

Accession MIMAT0026902
Sequence

24 - 

gcggugaucccgauggugugagc

 - 46

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-598-3p

Accession MIMAT0006455
Sequence

61 - 

uacgucaucguugucaucguca

 - 82

Get sequence
Deep sequencing21377 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).