Stem-loop sequence mml-mir-597

Accession MI0007858
Description Macaca mulatta miR-597 stem-loop
Gene family MIPF0000479; mir-597
Stem-loop
   u   --        ---    --gu   a uu  c          aagaga 
5'  acu  uacucuac   augu    guc c  ga gaccacugug      g
    |||  ||||||||   ||||    ||| |  || ||||||||||       
3'  ugg  gugagaug   ugcg    cgg g  cu uuggugacau      u
   c   uc        caa    aacu   g uu  c          guaaaa 
Get sequence
Deep sequencing
1 reads, 0.122 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 10974733-10974829 [-]
sense
ENSMMUT00000001377 ; TNKS-201; intron 20
Database links

Mature sequence mml-miR-597

Accession MIMAT0006454
Sequence

16 - 

ugugucacuugacgaccacugu

 - 37

Get sequence
Evidence by similarity; MI0003609
Predicted targets

References

1