Stem-loop sequence mml-mir-592

Accession MI0007856
Description Macaca mulatta miR-592 stem-loop
Gene family MIPF0000340; mir-592
Stem-loop
---------ua     c     ca        a    c        gu    a 
           uuaug cauga  uuguguca uaug gaugaugu  ugug u
           ||||| |||||  |||||||| |||| ||||||||  ||||  
           aaugc guacu  aacgcagu gugc cuacugcg  acac g
caacacugcag     a     ac        g    a        --    g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
3: 164603207-164603303 [-]
sense
ENSMMUT00000021363 ; GRM8-201; intron 2
Database links

Mature sequence mml-miR-592-5p

Accession MIMAT0006452
Sequence

16 - 

uugugucaauaugcgaugaugu

 - 37

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-592-3p

Accession MIMAT0026901
Sequence

55 - 

ucaucacguggugacgcaaca

 - 75

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).