Stem-loop sequence mml-mir-589

Accession MI0007854
Description Macaca mulatta miR-589 stem-loop
Gene family MIPF0000496; mir-589
Stem-loop
   ucca   ugu  cca     cc   a   c  -      c       u   u 
5'     gcc   gc   gcagc  cug gaa ca cgucug ucugagc ggg a
       |||   ||   |||||  ||| ||| || |||||| ||||||| ||| c
3'     cgg   cg   cgucg  gac cuu gu gcagac agacuug ucc u
   ---c   --u  -ac     ca   c   c  c      a       -   g 
Get sequence
Deep sequencing
2 reads, 0.184 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr3: 43884548-43884646 [+]
intergenic
Database links

Mature sequence mml-miR-589

Accession MIMAT0006449
Sequence

24 - 

ugagaaccacgucugcucugag

 - 45

Get sequence
Evidence by similarity; MI0003599
Predicted targets

References

1