Stem-loop sequence mml-mir-589

Accession MI0007854
Description Macaca mulatta miR-589 stem-loop
Gene family MIPF0000496; mir-589
Stem-loop
ucca   ugu  cca     cc   a   c  -      c       u   u 
    gcc   gc   gcagc  cug gaa ca cgucug ucugagc ggg a
    |||   ||   |||||  ||| ||| || |||||| ||||||| ||| c
    cgg   cg   cgucg  gac cuu gu gcagac agacuug ucc u
---c   --u  -ac     ca   c   c  c      a       -   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
3: 43496568-43496666 [+]
sense
ENSMMUT00000007125 ; FBXL18-202; intron 2
ENSMMUT00000007121 ; FBXL18-201; intron 2
ENSMMUT00000007123 ; FBXL18-203; intron 2
Database links

Mature sequence mml-miR-589

Accession MIMAT0006449
Sequence

24 - 

ugagaaccacgucugcucugag

 - 45

Get sequence
Evidence by similarity; MI0003599
Predicted targets

References

1