Stem-loop sequence mml-mir-587

Accession MI0007853
Description Macaca mulatta miR-587 stem-loop
Gene family MIPF0000563; mir-587
Stem-loop
   cuccua   acccucu      a                gcc    ga 
5'       ggc       uuccac ggugaugaguuacagg   cagg  a
         |||       |||||| ||||||||||||||||   ||||  u
3'       ccg       aaggug ucacuacucagugucc   gucu  g
   -cauac   -------      g                -ac    gu 
Get sequence
Deep sequencing
4 reads, 1.18 reads per million, 7 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr4: 105012620-105012709 [+]
antisense
ENSMMUT00000009979 ; SNX9-201; intron 9
ENSMMUT00000009978 ; SNX9-202; intron 9
Database links

Mature sequence mml-miR-587

Accession MIMAT0006448
Sequence

16 - 

uuuccacaggugaugaguuac

 - 36

Get sequence
Evidence by similarity; MI0003595
Predicted targets

References

1