Stem-loop sequence mml-mir-586

AccessionMI0007852 (change log)
DescriptionMacaca mulatta miR-586 stem-loop
Gene family MIPF0000467; mir-586
Stem-loop
   -----------au   -                 au            -   -  a 
5'              ggg guaaaaccauuaugcau  uguauuuuuagg ucc ca u
                ||| |||||||||||||||||  |||||||||||| ||| || a
3'              cuc uauuuugguaauacgua  acguaaaaaucc agg gu c
   uauucuucuauuu   a                 --            c   u  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 46307347-46307445 [-]
intergenic
Database links

Mature sequence mml-miR-586

Accession MIMAT0006447
Sequence

16 - 

uaugcauauuguauuuuuaggucc

 - 39

Get sequence
Evidence by similarity; MI0003594
Predicted targets

References

1