Stem-loop sequence mml-mir-586

AccessionMI0007852
DescriptionMacaca mulatta miR-586 stem-loop
Gene family MIPF0000467; mir-586
Stem-loop
-----------au   -                 au            -   -  a 
             ggg guaaaaccauuaugcau  uguauuuuuagg ucc ca u
             ||| |||||||||||||||||  |||||||||||| ||| || a
             cuc uauuuugguaauacgua  acguaaaaaucc agg gu c
uauucuucuauuu   a                 --            c   u  g 
Get sequence
Deep sequencing
1 reads, 0.0921 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-586

Accession MIMAT0006447
Sequence

16 - 

uaugcauauuguauuuuuaggucc

 - 39

Get sequence
Evidence by similarity; MI0003594
Predicted targets

References

1