Stem-loop sequence mml-mir-584

AccessionMI0007851
DescriptionMacaca mulatta miR-584 stem-loop
Gene family MIPF0000533; mir-584
Stem-loop
-------     u         uua     u            g a   ug 
       uaggg gaccagcca   ugguu gccugggacuga g auu  c
       ||||| |||||||||   ||||| |||||||||||| | |||   
       guccc uugguuggu   accaa cggaccuugacu u uag  u
caacgaa     u         cgg     c            g a   gg 
Get sequence
Deep sequencing
390 reads, 20.5 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr6: 147128262-147128358 [-]
antisense
ENSMMUT00000029084 ; SYNPO-203; intron 2
Database links

Mature sequence mml-miR-584-5p

Accession MIMAT0006446
Sequence

16 - 

uuaugguuugccugggacugag

 - 37

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-584-3p

Accession MIMAT0026900
Sequence

57 - 

aguuccaggccaaccaggcug

 - 77

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).