Stem-loop sequence mml-mir-584

AccessionMI0007851 (change log)
DescriptionMacaca mulatta miR-584 stem-loop
Gene family MIPF0000533; mir-584
Stem-loop
   -------     u         uua     u            g a   ug 
5'        uaggg gaccagcca   ugguu gccugggacuga g auu  c
          ||||| |||||||||   ||||| |||||||||||| | |||   
3'        guccc uugguuggu   accaa cggaccuugacu u uag  u
   caacgaa     u         cgg     c            g a   gg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 147178502-147178598 [-]
antisense
ENSMMUT00000029084 ; SYNPO-203; intron 2
Database links

Mature sequence mml-miR-584-5p

Accession MIMAT0006446
Sequence

16 - 

uuaugguuugccugggacugag

 - 37

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-584-3p

Accession MIMAT0026900
Sequence

57 - 

aguuccaggccaaccaggcug

 - 77

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).