Stem-loop sequence mml-mir-584

Accession MI0007851
Description Macaca mulatta miR-584 stem-loop
Gene family MIPF0000533; mir-584
Stem-loop
-------     u         uua     u            g a   ug 
       uaggg gaccagcca   ugguu gccugggacuga g auu  c
       ||||| |||||||||   ||||| |||||||||||| | |||   
       guccc uugguuggu   accaa cggaccuugacu u uag  u
caacgaa     u         cgg     c            g a   gg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 145581986-145582082 [-]
sense
ENSMMUT00000027854 ; SH3TC2-202; intron 1
Database links

Mature sequence mml-miR-584-5p

Accession MIMAT0006446
Sequence

16 - 

uuaugguuugccugggacugag

 - 37

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-584-3p

Accession MIMAT0026900
Sequence

57 - 

aguuccaggccaaccaggcug

 - 77

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).