|
miRBase |
|
Stem-loop sequence mml-mir-583 |
|||||
| Accession | MI0007850 | ||||
| Description | Macaca mulatta miR-583 stem-loop | ||||
| Gene family | MIPF0000482; mir-583 | ||||
| Stem-loop |
aacucgcacauuu a - accaaagagg aggucccaguacugc aggg |||||||||| ||||||||||||||| ||| a ugguuucucc uccagggucaugacg uucu ------------- a a |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-583 |
|
| Accession | MIMAT0006445 |
| Sequence |
16 - caaagaggaaggucccaguac - 36 |
| Evidence | by similarity; MI0003590 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|