Stem-loop sequence mml-mir-583

AccessionMI0007850 (change log)
DescriptionMacaca mulatta miR-583 stem-loop
Gene family MIPF0000482; mir-583
Stem-loop
   aacucgcacauuu          a               -     
5'              accaaagagg aggucccaguacugc aggg 
                |||||||||| ||||||||||||||| ||| a
3'              ugguuucucc uccagggucaugacg uucu 
   -------------          a               a     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 93058756-93058830 [+]
intergenic
Database links

Mature sequence mml-miR-583

Accession MIMAT0006445
Sequence

16 - 

caaagaggaaggucccaguac

 - 36

Get sequence
Evidence by similarity; MI0003590
Predicted targets

References

1