Stem-loop sequence mml-mir-583

Accession MI0007850
Description Macaca mulatta miR-583 stem-loop
Gene family MIPF0000482; mir-583
Stem-loop
   aacucgcacauuu          a               -     
5'              accaaagagg aggucccaguacugc aggg 
                |||||||||| ||||||||||||||| ||| a
3'              ugguuucucc uccagggucaugacg uucu 
   -------------          a               a     
Get sequence
Deep sequencing
13 reads, 0.722 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr6: 93244554-93244628 [+]
intergenic
Database links

Mature sequence mml-miR-583

Accession MIMAT0006445
Sequence

16 - 

caaagaggaaggucccaguac

 - 36

Get sequence
Evidence by similarity; MI0003590
Predicted targets

References

1