Stem-loop sequence mml-mir-583

Accession MI0007850
Description Macaca mulatta miR-583 stem-loop
Gene family MIPF0000482; mir-583
Stem-loop
aacucgcacauuu          a               -     
             accaaagagg aggucccaguacugc aggg 
             |||||||||| ||||||||||||||| ||| a
             ugguuucucc uccagggucaugacg uucu 
-------------          a               a     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 92292832-92292906 [+]
intergenic
Database links

Mature sequence mml-miR-583

Accession MIMAT0006445
Sequence

16 - 

caaagaggaaggucccaguac

 - 36

Get sequence
Evidence by similarity; MI0003590
Predicted targets

References

1