Stem-loop sequence mml-mir-581

AccessionMI0007848 (change log)
DescriptionMacaca mulatta miR-581 stem-loop
Gene family MIPF0000466; mir-581
Stem-loop
   -------        aac        -       g       g   uuuua 
5'        guucugug   guauucuu guguucu uagauca ugc     g
          ||||||||   |||||||| ||||||| ||||||| |||     a
3'        caagacac   cauaagaa cacaaga aucuagu gug     a
   cgucuac        auc        a       g       -   uuuaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 54874159-54874254 [-]
intergenic
Database links

Mature sequence mml-miR-581

Accession MIMAT0006442
Sequence

16 - 

ucuuguguucuguagaucagu

 - 36

Get sequence
Evidence by similarity; MI0003588
Predicted targets

References

1