Stem-loop sequence mml-mir-581

Accession MI0007848
Description Macaca mulatta miR-581 stem-loop
Gene family MIPF0000466; mir-581
Stem-loop
-------        aac        -       g       g   uuuua 
       guucugug   guauucuu guguucu uagauca ugc     g
       ||||||||   |||||||| ||||||| ||||||| |||     a
       caagacac   cauaagaa cacaaga aucuagu gug     a
cgucuac        auc        a       g       -   uuuaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 51614709-51614804 [-]
intergenic
Database links

Mature sequence mml-miR-581

Accession MIMAT0006442
Sequence

16 - 

ucuuguguucuguagaucagu

 - 36

Get sequence
Evidence by similarity; MI0003588
Predicted targets

References

1