Stem-loop sequence mml-mir-580

DescriptionMacaca mulatta miR-580 stem-loop
Gene family MIPF0000515; mir-580
auaa      cag                                 uaa 
    aauuuc   uuggaaccuaaugauucaucagacucagauauu   g
    ||||||   |||||||||||||||||||||||||||||||||   u
    uuaaag   gaccuuggauuacuaaguagucugaguuuauga   u
----      acu                                 caa 
Get sequence
Deep sequencing
15 reads, 0.285 reads per million, 6 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr6: 36406493-36406589 [-]
Database links

Mature sequence mml-miR-580

Accession MIMAT0006441

61 - 


 - 82

Get sequence
Evidence by similarity; MI0003587
Predicted targets
