Stem-loop sequence mml-mir-580

Accession MI0007847
Description Macaca mulatta miR-580 stem-loop
Gene family MIPF0000515; mir-580
Stem-loop
auaa      cag                                 uaa 
    aauuuc   uuggaaccuaaugauucaucagacucagauauu   g
    ||||||   |||||||||||||||||||||||||||||||||   u
    uuaaag   gaccuuggauuacuaaguagucugaguuuauga   u
----      acu                                 caa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 35940057-35940153 [-]
intergenic
Database links

Mature sequence mml-miR-580

Accession MIMAT0006441
Sequence

61 - 

uugagucugaugaaucauuagg

 - 82

Get sequence
Evidence by similarity; MI0003587
Predicted targets

References

1