Stem-loop sequence mml-mir-579

Accession MI0007846
Description Macaca mulatta miR-579 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
cauauuag   a                               gc      aa 
        guu augcaaaaguaaucgcgguuugugccaaaug  gauuug  u
        ||| |||||||||||||||||||||||||||||||  ||||||   
        cga uacguuuucauuagcgccaaacaugguuuac  uuaaau  u
--------   c                               --      aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 32490193-32490290 [-]
sense
ENSMMUT00000001862 ; ZFR-202; intron 4
ENSMMUT00000041885 ; ZFR-201; intron 14
ENSMMUT00000041884 ; ZFR-203; intron 15
Database links

Mature sequence mml-miR-579

Accession MIMAT0006440
Sequence

62 - 

uucauuugguacaaaccgcgauu

 - 84

Get sequence
Evidence by similarity; MI0003586
Predicted targets

References

1