Stem-loop sequence mml-mir-579

DescriptionMacaca mulatta miR-579 stem-loop
Gene family MIPF0000317; mir-548
cauauuag   a                               gc      aa 
        guu augcaaaaguaaucgcgguuugugccaaaug  gauuug  u
        ||| |||||||||||||||||||||||||||||||  ||||||   
        cga uacguuuucauuagcgccaaacaugguuuac  uuaaau  u
--------   c                               --      aa 
Get sequence
Deep sequencing
1 reads, 0.164 reads per million, 3 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr6: 32978332-32978429 [-]
Database links

Mature sequence mml-miR-579

Accession MIMAT0006440

62 - 


 - 84

Get sequence
Evidence by similarity; MI0003586
Predicted targets
