Stem-loop sequence mml-mir-577

Accession MI0007844
Description Macaca mulatta miR-577 stem-loop
Gene family MIPF0000530; mir-577
Stem-loop
-----------    gg                 a      u     augag 
           uggg  aaugaagaguagauaaa uauugg accug     u
           ||||  ||||||||||||||||| |||||| |||||     g
           accc  uuacuucucgucuauuu auaacu uggac     u
cauucaucuau    uu                 c      u     cggag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
5: 107536661-107536756 [+]
sense
ENSMMUT00000020279 ; UGT8-201; intron 2
Database links

Mature sequence mml-miR-577-5p

Accession MIMAT0006438
Sequence

16 - 

uagauaaaauauugguaccug

 - 36

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-577-3p

Accession MIMAT0026899
Sequence

52 - 

gguuucaauacuuuaucugcuc

 - 73

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).