Stem-loop sequence mml-mir-577

Accession MI0007844
Description Macaca mulatta miR-577 stem-loop
Gene family MIPF0000530; mir-577
Stem-loop
   -----------    gg                 a      u     augag 
5'            uggg  aaugaagaguagauaaa uauugg accug     u
              ||||  ||||||||||||||||| |||||| |||||     g
3'            accc  uuacuucucgucuauuu auaacu uggac     u
   cauucaucuau    uu                 c      u     cggag 
Get sequence
Deep sequencing
2687 reads, 35.1 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr5: 108859184-108859279 [+]
intergenic
Database links

Mature sequence mml-miR-577-5p

Accession MIMAT0006438
Sequence

16 - 

uagauaaaauauugguaccug

 - 36

Get sequence
Deep sequencing 10 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-577-3p

Accession MIMAT0026899
Sequence

52 - 

gguuucaauacuuuaucugcuc

 - 73

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).