|
miRBase |
|
Stem-loop sequence mml-mir-577 |
|||||
| Accession | MI0007844 | ||||
| Description | Macaca mulatta miR-577 stem-loop | ||||
| Gene family | MIPF0000530; mir-577 | ||||
| Stem-loop |
----------- gg a u augag uggg aaugaagaguagauaaa uauugg accug u |||| ||||||||||||||||| |||||| ||||| g accc uuacuucucgucuauuu auaacu uggac u cauucaucuau uu c u cggag |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-577 |
|
| Accession | MIMAT0006438 |
| Sequence |
16 - uagauaaaauauugguaccug - 36 |
| Evidence | by similarity; MI0003584 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|