Stem-loop sequence mml-mir-577

AccessionMI0007844 (change log)
DescriptionMacaca mulatta miR-577 stem-loop
Gene family MIPF0000530; mir-577
Stem-loop
   -----------    gg                 a      u     augag 
5'            uggg  aaugaagaguagauaaa uauugg accug     u
              ||||  ||||||||||||||||| |||||| |||||     g
3'            accc  uuacuucucgucuauuu auaacu uggac     u
   cauucaucuau    uu                 c      u     cggag 
Get sequence
Deep sequencing
6676 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 113761487-113761582 [+]
intergenic
Database links

Mature sequence mml-miR-577-5p

Accession MIMAT0006438
Sequence

16 - 

uagauaaaauauugguaccug

 - 36

Get sequence
Deep sequencing6653 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-577-3p

Accession MIMAT0026899
Sequence

52 - 

gguuucaauacuuuaucugcuc

 - 73

Get sequence
Deep sequencing17 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).