Stem-loop sequence mml-mir-576

Accession MI0007843
Description Macaca mulatta miR-576 stem-loop
Gene family MIPF0000493; mir-576
Stem-loop
-----ua                       c            g   ua 
       caauccagugaggauucuaauuu uccacaucuuug uaa  a
       ||||||||||||||||||||||| |||||||||||| |||   
       guuagguuacuccuaagguuaaa agguguagaaac guu  g
aauauug                       a            g   uu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
5: 102425182-102425276 [+]
sense
ENSMMUT00000032687 ; SEC24B-201; intron 4
Database links

Mature sequence mml-miR-576-5p

Accession MIMAT0006436
Sequence

16 - 

auucuaauuucuccacaucuuu

 - 37

Get sequence
Evidence by similarity; MI0003583
Predicted targets

Mature sequence mml-miR-576-3p

Accession MIMAT0006437
Sequence

55 - 

aagauguggaaaaauuggaauc

 - 76

Get sequence
Evidence by similarity; MI0003583
Predicted targets

References

1