Stem-loop sequence mml-mir-576

DescriptionMacaca mulatta miR-576 stem-loop
Gene family MIPF0000493; mir-576
   -----ua                       c            g   ua 
5'        caauccagugaggauucuaauuu uccacaucuuug uaa  a
          ||||||||||||||||||||||| |||||||||||| |||   
3'        guuagguuacuccuaagguuaaa agguguagaaac guu  g
   aauauug                       a            g   uu 
Get sequence
Deep sequencing
24 reads, 0.573 reads per million, 7 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr5: 103707676-103707770 [+]
Database links

Mature sequence mml-miR-576-5p

Accession MIMAT0006436

16 - 


 - 37

Get sequence
Evidence by similarity; MI0003583
Predicted targets

Mature sequence mml-miR-576-3p

Accession MIMAT0006437

55 - 


 - 76

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003583
Predicted targets
