Stem-loop sequence mml-mir-573

Accession MI0007842
Description Macaca mulatta miR-573 stem-loop
Gene family MIPF0000561; mir-573
Stem-loop
   --uuuagagg g  u      agugau       -cg     ga cu  u 
5'           u uc cccuga      gcauaac   aucag  u  ac c
             | || ||||||      |||||||   |||||  |  ||  
3'           g ag gggacu      uguauug   ugguu  a  ug a
   guuuuggaga g  u      guucgu       aaa     uc ac  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr5: 19634545-19634643 [-]
sense
ENSMMUT00000006757 ; CCDC149-201; intron 2
ENSMMUT00000042374 ; CCDC149-202; intron 3
Database links

Mature sequence mml-miR-573

Accession MIMAT0006435
Sequence

16 - 

cugaagugaugcauaaccgaucag

 - 39

Get sequence
Evidence by similarity; MI0003580
Predicted targets

References

1