Stem-loop sequence mml-mir-573

Accession MI0007842
Description Macaca mulatta miR-573 stem-loop
Gene family MIPF0000561; mir-573
Stem-loop
--uuuagagg g  u      agugau       -cg     ga cu  u 
          u uc cccuga      gcauaac   aucag  u  ac c
          | || ||||||      |||||||   |||||  |  ||  
          g ag gggacu      uguauug   ugguu  a  ug a
guuuuggaga g  u      guucgu       aaa     uc ac  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
5: 19274930-19275028 [-]
intergenic
Database links

Mature sequence mml-miR-573

Accession MIMAT0006435
Sequence

16 - 

cugaagugaugcauaaccgaucag

 - 39

Get sequence
Evidence by similarity; MI0003580
Predicted targets

References

1