Stem-loop sequence mml-mir-572

Accession MI0007841
Description Macaca mulatta miR-572 stem-loop
Gene family MIPF0000537; mir-572
Stem-loop
   gucgaggccguggcccggaagugaucg          g  -    -a     c 
5'                            gggccgccgc ga cgga  gggcg c
                              |||||||||| || ||||  |||||  
3'                            cccgguggcg cu gccu  uucgu u
   -----------agggcgcccggaccga          g  c    gc     c 
Get sequence
Deep sequencing
7 reads, 0.276 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr20: 2284796-2284890 [-]
sense
ENSMMUT00000027028 ; ABCA3-201; intron 23
ENSMMUT00000027029 ; ABCA3-202; intron 24
Clustered miRNAs
< 10kb from mml-mir-572
mml-mir-940 chr20: 2288681-2288774 [+]
mml-mir-572 chr20: 2284796-2284890 [-]
Database links

Mature sequence mml-miR-572

Accession MIMAT0006434
Sequence

61 - 

guccgcucggcgguggccca

 - 80

Get sequence
Evidence by similarity; MI0003579
Predicted targets

References

1