Stem-loop sequence mml-mir-572

Accession MI0007841
Description Macaca mulatta miR-572 stem-loop
Gene family MIPF0000537; mir-572
Stem-loop
gucgaggccguggcccggaagugaucg          g  -    -a     c 
                           gggccgccgc ga cgga  gggcg c
                           |||||||||| || ||||  |||||  
                           cccgguggcg cu gccu  uucgu u
-----------agggcgcccggaccga          g  c    gc     c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
20: 2267998-2268092 [-]
sense
ENSMMUT00000027024 ; RNPS1-201; intron 1
ENSMMUT00000027023 ; RNPS1-202; intron 1
ENSMMUT00000027025 ; RNPS1-203; 5'UTR (exon 1)
Clustered miRNAs
< 10kb from mml-mir-572
mml-mir-940 20: 2271884-2271977 [+]
mml-mir-572 20: 2267998-2268092 [-]
Database links

Mature sequence mml-miR-572

Accession MIMAT0006434
Sequence

61 - 

guccgcucggcgguggccca

 - 80

Get sequence
Evidence by similarity; MI0003579
Predicted targets

References

1