Stem-loop sequence mml-mir-570

Accession MI0007840
Description Macaca mulatta miR-570 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
uauu             c        ag        a   c 
    agguuggugcaaa guaauugc  uuuuugcc uua u
    ||||||||||||| ||||||||  |||||||| |||  
    uccaaccacguuu cauuaacg  gaaaacgg aau u
----             c        au        a   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 4558697-4558776 [-]
intergenic
Database links

Mature sequence mml-miR-570

Accession MIMAT0006433
Sequence

51 - 

caaaaguagcaauuaccuuugc

 - 72

Get sequence
Evidence by similarity; MI0003577
Predicted targets

References

1