Stem-loop sequence mml-mir-570

Accession MI0007840
Description Macaca mulatta miR-570 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   uauu             c        ag        a   c 
5'     agguuggugcaaa guaauugc  uuuuugcc uua u
       ||||||||||||| ||||||||  |||||||| |||  
3'     uccaaccacguuu cauuaacg  gaaaacgg aau u
   ----             c        au        a   u 
Get sequence
Deep sequencing
15 reads, 1.4 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr6: 4615819-4615898 [-]
intergenic
Database links

Mature sequence mml-miR-570

Accession MIMAT0006433
Sequence

51 - 

caaaaguagcaauuaccuuugc

 - 72

Get sequence
Evidence by similarity; MI0003577
Predicted targets

References

1