Stem-loop sequence mml-mir-569

AccessionMI0007839
DescriptionMacaca mulatta miR-569 stem-loop
Gene family MIPF0000535; mir-569
Stem-loop
-    uu    ga        g     --       aacagcaucagca 
 ggua  guua  uuaauuuu uggga  cauuaac             g
 ||||  ||||  |||||||| |||||  |||||||              
 uuau  cagu  aauugaaa guccu  guaauug             c
u    uu    -g        g     aa       auuucgacuacaa 
Get sequence
Deep sequencing
1 reads, 0.122 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr2: 118475066-118475161 [+]
intergenic
Database links

Mature sequence mml-miR-569

Accession MIMAT0006432
Sequence

61 - 

aguuaaugaauccuggaaagu

 - 81

Get sequence
Evidence by similarity; MI0003576
Predicted targets

References

1