Stem-loop sequence mml-mir-569

Accession MI0007839
Description Macaca mulatta miR-569 stem-loop
Gene family MIPF0000535; mir-569
Stem-loop
-    uu    ga        g     --       aacagcaucagca 
 ggua  guua  uuaauuuu uggga  cauuaac             g
 ||||  ||||  |||||||| |||||  |||||||              
 uuau  cagu  aauugaaa guccu  guaauug             c
u    uu    -g        g     aa       auuucgacuacaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
2: 115944653-115944748 [+]
sense
ENSMMUT00000031320 ; MMU.2391-202; intron 20
ENSMMUT00000031322 ; MMU.2391-203; intron 20
ENSMMUT00000031323 ; MMU.2391-204; intron 20
ENSMMUT00000031321 ; MMU.2391-205; intron 20
ENSMMUT00000045658 ; MMU.2391-201; intron 21
Database links

Mature sequence mml-miR-569

Accession MIMAT0006432
Sequence

61 - 

aguuaaugaauccuggaaagu

 - 81

Get sequence
Evidence by similarity; MI0003576
Predicted targets

References

1