Stem-loop sequence mml-mir-567

AccessionMI0007837
DescriptionMacaca mulatta miR-567 stem-loop
Gene family MIPF0000555; mir-567
Stem-loop
--------ggauucuuacaggacacu            g      ---  u 
                          auguucuuccag acagaa   ca u
                          |||||||||||| ||||||   || c
                          uacaagaagguc uguuuu   gu u
ucguuauugaaaaaaauuucaaaacg            a      auc  u 
Get sequence
Deep sequencing
3 reads, 0.497 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr2: 32272678-32272771 [+]
antisense
ENSMMUT00000047002 ; SLC9C1-203; intron 15
ENSMMUT00000022605 ; SLC9C1-204; intron 17
ENSMMUT00000047004 ; SLC9C1-202; intron 21
ENSMMUT00000047005 ; SLC9C1-201; intron 22
Database links

Mature sequence mml-miR-567

Accession MIMAT0006430
Sequence

16 - 

acuauguucuuccaggacagaac

 - 38

Get sequence
Evidence by similarity; MI0003573
Predicted targets

References

1