Stem-loop sequence mml-mir-567

Accession MI0007837
Description Macaca mulatta miR-567 stem-loop
Gene family MIPF0000555; mir-567
Stem-loop
--------ggauucuuacaggacacu            g      ---  u 
                          auguucuuccag acagaa   ca u
                          |||||||||||| ||||||   || c
                          uacaagaagguc uguuuu   gu u
ucguuauugaaaaaaauuucaaaacg            a      auc  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
2: 32211015-32211108 [+]
sense
ENSMMUT00000022602 ; C3orf52-201; intron 5
Database links

Mature sequence mml-miR-567

Accession MIMAT0006430
Sequence

16 - 

acuauguucuuccaggacagaac

 - 38

Get sequence
Evidence by similarity; MI0003573
Predicted targets

References

1