Stem-loop sequence mml-mir-562

AccessionMI0007835
DescriptionMacaca mulatta miR-562 stem-loop
Gene family MIPF0000512; mir-562
Stem-loop
agugaa      ---   ---u  u     -   u       -c      a  g 
      auugcu   ggg    ca auggu cag cuacuuu  agagua uu u
      ||||||   |||    || ||||| ||| |||||||  |||||| ||  
      uaacgg   ccc    gu uacca guc gaugaaa  uuuuau aa g
------      ugu   uuac  u     u   -       cu      g  a 
Get sequence
Deep sequencing
3 reads, 0.761 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr12: 95935402-95935496 [+]
sense
ENSMMUT00000021269 ; DIS3L2-202; intron 2
ENSMMUT00000021267 ; DIS3L2-201; intron 5
Database links

Mature sequence mml-miR-562

Accession MIMAT0006428
Sequence

61 - 

aaaguagcuguaccauuugc

 - 80

Get sequence
Evidence by similarity; MI0003568
Predicted targets

References

1