Stem-loop sequence mml-mir-562

Accession MI0007835
Description Macaca mulatta miR-562 stem-loop
Gene family MIPF0000512; mir-562
Stem-loop
agugaa      ---   ---u  u     -   u       -c      a  g 
      auugcu   ggg    ca auggu cag cuacuuu  agagua uu u
      ||||||   |||    || ||||| ||| |||||||  |||||| ||  
      uaacgg   ccc    gu uacca guc gaugaaa  uuuuau aa g
------      ugu   uuac  u     u   -       cu      g  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
12: 96020650-96020744 [+]
sense
ENSMMUT00000021267 ; DIS3L2-201; intron 9
Database links

Mature sequence mml-miR-562

Accession MIMAT0006428
Sequence

61 - 

aaaguagcuguaccauuugc

 - 80

Get sequence
Evidence by similarity; MI0003568
Predicted targets

References

1