Stem-loop sequence mml-mir-557

AccessionMI0007833
DescriptionMacaca mulatta miR-557 stem-loop
Gene family MIPF0000520; mir-557
Stem-loop
agaaugggcaaaugaauaguaaa  ug    cc      c u   ugc   u    a 
                       uu  gagg  uggggc c ccc   ugc ggac a
                       ||  ||||  |||||| | |||   ||| ||||  
                       aa  uucu  auuccg g ggg   acg ucug g
-------------agguggagga  gu    --      a u   --u   -    u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr1: 198767395-198767492 [+]
intergenic
Database links

Mature sequence mml-miR-557

Accession MIMAT0006426
Sequence

61 - 

gucugcaugggugagccuuaucu

 - 83

Get sequence
Evidence by similarity; MI0003563
Predicted targets

References

1