Stem-loop sequence mml-mir-557

AccessionMI0007833 (change log)
DescriptionMacaca mulatta miR-557 stem-loop
Gene family MIPF0000520; mir-557
Stem-loop
   agaaugggcaaaugaauaguaaauuuggaggccug    c u   ugc   u    a 
5'                                    gggc c ccc   ugc ggac a
                                      |||| | |||   ||| ||||  
3'                                    uccg g ggg   acg ucug g
   ---------------agguggaggaaaguuucuau    a u   --u   -    u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 199328583-199328680 [-]
intergenic
Database links

Mature sequence mml-miR-557

Accession MIMAT0006426
Sequence

61 - 

gucugcaugggugagccuuaucu

 - 83

Get sequence
Evidence by similarity; MI0003563
Predicted targets

References

1