Stem-loop sequence mml-mir-557

Accession MI0007833
Description Macaca mulatta miR-557 stem-loop
Gene family MIPF0000520; mir-557
Stem-loop
   agaaugggcaaaugaauaguaaa  ug    cc      c u   ugc   u    a 
5'                        uu  gagg  uggggc c ccc   ugc ggac a
                          ||  ||||  |||||| | |||   ||| ||||  
3'                        aa  uucu  auuccg g ggg   acg ucug g
   -------------agguggagga  gu    --      a u   --u   -    u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr1: 198767395-198767492 [+]
intergenic
Database links

Mature sequence mml-miR-557

Accession MIMAT0006426
Sequence

61 - 

gucugcaugggugagccuuaucu

 - 83

Get sequence
Evidence by similarity; MI0003563
Predicted targets

References

1