Stem-loop sequence mml-mir-556

AccessionMI0007832 (change log)
DescriptionMacaca mulatta miR-556 stem-loop
Gene family MIPF0000475; mir-556
Stem-loop
   gauaguaau         g a  c            ---  uuc 
5'          gagaaagau a cu auuguaauauga   gc   a
            ||||||||| | || ||||||||||||   ||   u
3'          uuuuuucua u ga uaacauuauacu   cg   u
   ------uuu         g c  u            uua  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 137127412-137127493 [+]
intergenic
Database links

Mature sequence mml-miR-556-5p

Accession MIMAT0006424
Sequence

16 - 

gaugaacucauuguaauaugag

 - 37

Get sequence
Evidence by similarity; MI0003562
Predicted targets

Mature sequence mml-miR-556-3p

Accession MIMAT0006425
Sequence

55 - 

auauuacaauuagcugaucuuu

 - 76

Get sequence
Evidence by similarity; MI0003562
Predicted targets

References

1