Stem-loop sequence mml-mir-554

Accession MI0007831
Description Macaca mulatta miR-554 stem-loop
Gene family MIPF0000551; mir-554
Stem-loop
-----a  u   uaaccuu      --------          --      acug 
      cc gag       ugcuag        uccugacuca  gccagu    a
      || |||       ||||||        ||||||||||  ||||||    u
      gg cuc       acgguu        gggacugggu  cgguca    c
ucuacg  u   --ucucu      uuauacuu          ga      cauu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 129984032-129984127 [+]
sense
ENSMMUT00000029917 ; TUFT1-201; intron 1
ENSMMUT00000046012 ; TUFT1-202; intron 1
ENSMMUT00000046011 ; TUFT1-203; intron 1
Database links

Mature sequence mml-miR-554

Accession MIMAT0006423
Sequence

16 - 

gcuaguccugacucagccagu

 - 36

Get sequence
Evidence by similarity; MI0003559
Predicted targets

References

1