Stem-loop sequence mml-mir-554

AccessionMI0007831
DescriptionMacaca mulatta miR-554 stem-loop
Gene family MIPF0000551; mir-554
Stem-loop
-----a  u   uaaccuu      --------          --      acug 
      cc gag       ugcuag        uccugacuca  gccagu    a
      || |||       ||||||        ||||||||||  ||||||    u
      gg cuc       acgguu        gggacugggu  cgguca    c
ucuacg  u   --ucucu      uuauacuu          ga      cauu 
Get sequence
Deep sequencing
4 reads, 1.13 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr1: 130506586-130506681 [+]
intergenic
Database links

Mature sequence mml-miR-554

Accession MIMAT0006423
Sequence

16 - 

gcuaguccugacucagccagu

 - 36

Get sequence
Evidence by similarity; MI0003559
Predicted targets

References

1