Stem-loop sequence mml-mir-553

Accession MI0007830
Description Macaca mulatta miR-553 stem-loop
Gene family MIPF0000487; mir-553
Stem-loop
        auuuua       aa           g  uu 
5' cuuca      uuugaaa  ggugagguuuu uu  g
   |||||      |||||||  ||||||||||| ||   
3' ggagu      agauuuu  ucacucuaaaa ag  u
        -----c       -g           g  uc 
Get sequence
Deep sequencing
35 reads, 1.93 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-553

Accession MIMAT0006422
Sequence

16 - 

aaaaaggugagguuuuguuuu

 - 36

Get sequence
Evidence by similarity; MI0003558
Predicted targets

References

1