|
miRBase |
|
Stem-loop sequence mml-mir-553 |
|||||
| Accession | MI0007830 | ||||
| Description | Macaca mulatta miR-553 stem-loop | ||||
| Gene family | MIPF0000487; mir-553 | ||||
| Stem-loop |
auuuua aa g uu cuuca uuugaaa ggugagguuuu uu g ||||| ||||||| ||||||||||| || ggagu agauuuu ucacucuaaaa ag u -----c -g g uc |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-553 |
|
| Accession | MIMAT0006422 |
| Sequence |
16 - aaaaaggugagguuuuguuuu - 36 |
| Evidence | by similarity; MI0003558 |
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|