Stem-loop sequence mml-mir-553

Accession MI0007830
Description Macaca mulatta miR-553 stem-loop
Gene family MIPF0000487; mir-553
Stem-loop
     auuuua       aa           g  uu 
cuuca      uuugaaa  ggugagguuuu uu  g
|||||      |||||||  ||||||||||| ||   
ggagu      agauuuu  ucacucuaaaa ag  u
     -----c       -g           g  uc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 103344920-103344987 [+]
sense
ENSMMUT00000046593 ; RTCD1-202; intron 8
ENSMMUT00000026849 ; RTCD1-201; intron 9
Database links

Mature sequence mml-miR-553

Accession MIMAT0006422
Sequence

16 - 

aaaaaggugagguuuuguuuu

 - 36

Get sequence
Evidence by similarity; MI0003558
Predicted targets

References

1