Stem-loop sequence mml-mir-552

AccessionMI0007829 (change log)
DescriptionMacaca mulatta miR-552 stem-loop
Gene family MIPF0000501; mir-552
Stem-loop
   accauuca                        uua       uguu    a 
5'         aauauaccacaguuuguuugacca   accuguu    gaag u
           ||||||||||||||||||||||||   |||||||    ||||  
3'         uuauauggugucaaacagauuggu   ugggcaa    uuuc g
   ------ac                        cag       ---c    c 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 33814719-33814813 [-]
sense
ENSMMUT00000007043 ; DLGAP3-201; exon 11
Database links

Mature sequence mml-miR-552

Accession MIMAT0006421
Sequence

60 - 

aacgggugacugguuagacaa

 - 80

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence by similarity; MI0003557
Predicted targets

References

1