Stem-loop sequence mml-mir-551b

Accession MI0007828
Description Macaca mulatta miR-551b stem-loop
Gene family MIPF0000360; mir-551
Stem-loop
agaugugc    c     ca          cg     - -aga    gug 
        ucuc uggcc  ugaaaucaag  ugggu g    ccug   c
        |||| |||||  ||||||||||  ||||| |    ||||    
        agag gucgg  acuuugguuc  accca c    ggac   a
-----aua    c     ag          au     g ggaa    aag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
2: 118520037-118520131 [-]
intergenic
Database links

Mature sequence mml-miR-551b-5p

Accession MIMAT0026898
Sequence

22 - 

gaaaucaagcgugggugaga

 - 41

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-551b-3p

Accession MIMAT0006420
Sequence

61 - 

gcgacccauacuugguuucag

 - 81

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).