|
miRBase |
|
Stem-loop sequence mml-mir-551b |
|||||
| Accession | MI0007828 | ||||
| Description | Macaca mulatta miR-551b stem-loop | ||||
| Gene family | MIPF0000360; mir-551 | ||||
| Stem-loop |
agaugugc c ca cg - -aga gug
ucuc uggcc ugaaaucaag ugggu g ccug c
|||| ||||| |||||||||| ||||| | ||||
agag gucgg acuuugguuc accca c ggac a
-----aua c ag au g ggaa aag
|
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-551b |
|
| Accession | MIMAT0006420 |
| Sequence |
61 - gcgacccauacuugguuucag - 81 |
| Evidence | by similarity; MI0003575 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|