Stem-loop sequence mml-mir-551a

Accession MI0007827
Description Macaca mulatta miR-551a stem-loop
Gene family MIPF0000360; mir-551
Stem-loop
   ggggacug  -   ug            c         ggg     ucuga 
5'         cc ggg  acccuggaaauc agagugggu   gccug     c
           || |||  |||||||||||| |||||||||   |||||      
3'         gg ccc  ugggaccuuugg ucucaccca   cggau     c
   -----aaa  u   gu            u         --g     cuuua 
Get sequence
Deep sequencing
235 reads, 4.13 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr1: 6674386-6674481 [-]
antisense
ENSMMUT00000047632 ; TP73-205; intron 2
ENSMMUT00000023268 ; TP73-203; intron 3
ENSMMUT00000047633 ; TP73-204; intron 3
ENSMMUT00000047635 ; TP73-201; intron 4
ENSMMUT00000023267 ; TP73-202; intron 4
Database links

Mature sequence mml-miR-551a

Accession MIMAT0006419
Sequence

61 - 

gcgacccacucuugguuucca

 - 81

Get sequence
Deep sequencing 7 reads, 4 experiments
Evidence by similarity; MI0003556
Predicted targets

References

1