Stem-loop sequence mml-mir-551a

Accession MI0007827
Description Macaca mulatta miR-551a stem-loop
Gene family MIPF0000360; mir-551
Stem-loop
ggggacug  -   ug            c         ggg     ucuga 
        cc ggg  acccuggaaauc agagugggu   gccug     c
        || |||  |||||||||||| |||||||||   |||||      
        gg ccc  ugggaccuuugg ucucaccca   cggau     c
-----aaa  u   gu            u         --g     cuuua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 6524006-6524101 [-]
sense
ENSMMUT00000013075 ; MEGF6-201; intron 4
Database links

Mature sequence mml-miR-551a

Accession MIMAT0006419
Sequence

61 - 

gcgacccacucuugguuucca

 - 81

Get sequence
Evidence by similarity; MI0003556
Predicted targets

References

1