Stem-loop sequence mml-mir-550

AccessionMI0007826 (change log)
DescriptionMacaca mulatta miR-550 stem-loop
Gene family MIPF0000334; mir-550
Stem-loop
   ugaugcuuu   g     u ca                  g c     gu 
5'          gcu gcugg g  gugccugaggggguaaga c cuguu  u
            ||| ||||| |  |||||||||||||||||| | |||||  g
3'          uga cgacc c  cacggacucccucauucu g gauag  u
   ---------   a     u ua                  - u     aa 
Get sequence
Deep sequencing
85 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 78421474-78421566 [+]
intergenic
Database links

Mature sequence mml-miR-550-5p

Accession MIMAT0006418
Sequence

22 - 

agugccugaggggguaagagccc

 - 44

Get sequence
Deep sequencing66 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-550-3p

Accession MIMAT0026897
Sequence

64 - 

cuuacucccucaggcacauc

 - 83

Get sequence
Deep sequencing17 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).