Stem-loop sequence mml-mir-549a

AccessionMI0007825 (change log)
Previous IDsmml-mir-549
DescriptionMacaca mulatta miR-549 stem-loop
Gene family MIPF0000470; mir-549
Stem-loop
   agacaugcaacucaaga                             cu     
5'                  auauauugagagcucauccauaguuguca  gucu 
                    |||||||||||||||||||||||||||||  ||| c
3'                  uauauaauucucgaguagguauuaacagu  uaga 
   ----------cggaccc                             ac     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 58404316-58404410 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-549a
mml-mir-549bchr7: 58404331-58404387 [+]
mml-mir-549achr7: 58404316-58404410 [-]
Database links

Mature sequence mml-miR-549a

Accession MIMAT0006417
Previous IDsmml-miR-549
Sequence

26 - 

agagcucauccauaguuguca

 - 46

Get sequence
Evidence by similarity; MI0003679
Predicted targets

References

1