Stem-loop sequence mml-mir-549a

Accession MI0007825
Previous IDs mml-mir-549
Description Macaca mulatta miR-549 stem-loop
Gene family MIPF0000470; mir-549
Stem-loop
   agacaugcaacucaaga                             cu     
5'                  auauauugagagcucauccauaguuguca  gucu 
                    |||||||||||||||||||||||||||||  ||| c
3'                  uauauaauucucgaguagguauuaacagu  uaga 
   ----------cggaccc                             ac     
Get sequence
Deep sequencing
10 reads, 0.272 reads per million, 7 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 59417049-59417143 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-549a
mml-mir-549b chr7: 59417064-59417120 [+]
mml-mir-549a chr7: 59417049-59417143 [-]
Database links

Mature sequence mml-miR-549a

Accession MIMAT0006417
Previous IDs mml-miR-549
Sequence

26 - 

agagcucauccauaguuguca

 - 46

Get sequence
Evidence by similarity; MI0003679
Predicted targets

References

1