Stem-loop sequence mml-mir-549

Accession MI0007825
Description Macaca mulatta miR-549 stem-loop
Gene family MIPF0000470; mir-549
Stem-loop
agacaugcaacucaaga                             cu     
                 auauauugagagcucauccauaguuguca  gucu 
                 |||||||||||||||||||||||||||||  ||| c
                 uauauaauucucgaguagguauuaacagu  uaga 
----------cggaccc                             ac     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 60001367-60001461 [-]
antisense
ENSMMUT00000002884 ; KIAA1199-201; intron 1
Clustered miRNAs
< 10kb from mml-mir-549
mml-mir-549b 7: 60001382-60001438 [+]
mml-mir-549 7: 60001367-60001461 [-]
Database links

Mature sequence mml-miR-549

Accession MIMAT0006417
Sequence

26 - 

agagcucauccauaguuguca

 - 46

Get sequence
Evidence by similarity; MI0003679
Predicted targets

References

1