Stem-loop sequence mml-mir-548f

Accession MI0007824
Description Macaca mulatta miR-548f stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
-auu                u     c  a   u       a 
    uagguuggugcaaaag aauug gg uuu gccauug a
    |||||||||||||||| ||||| || ||| |||||||  
    aucuaaccacguuuuc uugac cc aaa cgguaau a
agau                c     a  a   c       g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1099214323795: 2317-2401 [+]
intergenic
Database links

Mature sequence mml-miR-548f

Accession MIMAT0006416
Sequence

52 - 

caaaaccacaguuccuuuugc

 - 72

Get sequence
Evidence by similarity; MI0003671
Predicted targets

References

1