Stem-loop sequence mml-mir-548f

AccessionMI0007824
DescriptionMacaca mulatta miR-548f stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
-auu                u     c  a   u       a 
    uagguuggugcaaaag aauug gg uuu gccauug a
    |||||||||||||||| ||||| || ||| |||||||  
    aucuaaccacguuuuc uugac cc aaa cgguaau a
agau                c     a  a   c       g 
Get sequence
Deep sequencing
93 reads, 2.13 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-548f

Accession MIMAT0006416
Sequence

52 - 

caaaaccacaguuccuuuugc

 - 72

Get sequence
Evidence by similarity; MI0003671
Predicted targets

References

1