Stem-loop sequence mml-mir-548f

Accession MI0007824
Description Macaca mulatta miR-548f stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   -auu                u     c  a   u       a 
5'     uagguuggugcaaaag aauug gg uuu gccauug a
       |||||||||||||||| ||||| || ||| |||||||  
3'     aucuaaccacguuuuc uugac cc aaa cgguaau a
   agau                c     a  a   c       g 
Get sequence
Deep sequencing
93 reads, 2.13 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-548f

Accession MIMAT0006416
Sequence

52 - 

caaaaccacaguuccuuuugc

 - 72

Get sequence
Evidence by similarity; MI0003671
Predicted targets

References

1