Stem-loop sequence mml-mir-548f

AccessionMI0007824 (change log)
DescriptionMacaca mulatta miR-548f stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention mml-mir-548f
(2 sentences)

Stem-loop
   -auu                u     c  a   u       a 
5'     uagguuggugcaaaag aauug gg uuu gccauug a
       |||||||||||||||| ||||| || ||| |||||||  
3'     aucuaaccacguuuuc uugac cc aaa cgguaau a
   agau                c     a  a   c       g 
Get sequence
Deep sequencing
512 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 43286002-43286086 [-]
intergenic
Database links

Mature sequence mml-miR-548f

Accession MIMAT0006416
Sequence

52 - 

caaaaccacaguuccuuuugc

 - 72

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence by similarity; MI0003671
Predicted targets

References

1